You are here

Nucleic Acids

FARFAR2 - Extra Minimize Hangs on Submittal

Category: 
Nucleic Acids

Hello,

I have attempted several times to start a new FARFAR2 run that uses one or two template PDBs for homology modeling. This seems to work well with default settings, but I need to supply data in the "Residues for 'extra' minimization" text field to relax the homology model near its endpoints.  When I include data in this field, it causes the popup "Submitting FARFAR2 job..." to display indefinitely. I waited overnight to see if this was just slowing things down quite a bit, but no success. 

Post Situation: 

RNA update library

Category: 
Nucleic Acids

Hi,

I'm building RNA structures of 4kb using rna_denovo. For some of my structures I have this error message: 

ERROR: hey update AtomLevelDomainMap & RNA_ChunkLibrary to not use magic numbers like 999 and 1000

ERROR:: Exit from: src/core/import_pose/libraries/RNA_ChunkLibrary.cc line: 551

protocols.jd2.JobDistributor: [ ERROR ]

[ERROR] Exception caught by JobDistributor for job S_000001

[ ERROR ]: Caught exception:

File: src/core/import_pose/libraries/RNA_ChunkLibrary.cc:551

Post Situation: 

connecting rna strands together

Category: 
Nucleic Acids

Hi there, could anyone please tell me how I can connect two rna strands together via a known linker  that I don't have a structure for ?

Supposedly: RNA 1 is uaugaaaaua

RNA2 is cggcgaaagccg

and their linker is uuu

making a total of :

uaugaaaauauuucggcgaaagccg

How can i do this via rna_denovo?

 

Thanks in advance for any help!

 

Post Situation: 

building a protein-dna homology model via cm_rosetta

Category: 
Nucleic Acids

Hello everyone, recently I've been trying to make a homology model with a protein chain along with a nucleotide chain within it based on an existing template, but .

post-partial threading Rosetta dislocates the nucleotides nearly 1000 angstrom away from the structure. .

Post Situation: 

Stepwise error

Category: 
Nucleic Acids

I am getting the following error while trying to assemble a 514-nucleotide long RNA using the "Stepwise" programme:

"one of your input pdbs -- native, alignment, or starting -- has a residue that is not found in the fasta!"

I have thoroughly checked my target fasta sequence  and the input PDB containing part of the RNA structure. There are no residue mismatches...then why am I getting this error?

Post Situation: 

duplex RNA

Category: 
Nucleic Acids

Hello,

I am using FARFAR to get the possible structures for a A-bulge RNA duplex with the following specifications:

Input sequence: CCGGCAGUGUG+CACACGUCGG

Input secstruct (((((.(((((+))))))))))

I need to keep the structure in the duplex form and not the hairpin. All output files I got with the mentioned specifications are RNA hairpins. Is there a way I can keep the structure in the duplex form.

 

thanks for yoyr help.

Best,

Amir

 

 

Post Situation: 

de novo RNA loop

Category: 
Nucleic Acids

Hello, 
I'm using the rosetta rna de novo tool to generate a rna hairpin, I used the RNA_Denovo_with_base_pair_steps demo as a guide to do it, however I get the error: Atom C1' 1 not found. I' m newbie using rosetta so I would really appreciate any help or guide about the problem. Thank you!

Post Situation: 

rna_denovo secstruct_general function

Category: 
Nucleic Acids

Hello all, I had a question about how to properly use the -secstruct_general flag to input non-canonical and canonical basepairing interactions. I'm trying to test this on a simple structure from the 3IRW RNA that has a non-canonical g a basepair but I keep reseiving errors.  I am running the following command with the following files.

 

rna_denovo.static.linuxgccrelease -nstruct 1 -fasta ../test.fasta -secstruct_file ../test.secstruct -secstruct_general ../test.secgen -minimize_rna true -out:file:silent testing.out 

Post Situation: 

error running "helix_preassemble_setup.py"

Category: 
Nucleic Acids

Dear Rosetta users,

I recently install Rosetta and want to work with Rna_Denovo, when I run the command line below I got this error:

------------------------------------------------------------------------------------------------------------------------------------------------

Post Situation: 

Pages

Subscribe to RSS - Nucleic Acids