Hi there, could anyone please tell me how I can connect two rna strands together via a known linker that I don't have a structure for ?
Supposedly: RNA 1 is uaugaaaaua
RNA2 is cggcgaaagccg
and their linker is uuu
making a total of :
uaugaaaauauuucggcgaaagccg
How can i do this via rna_denovo?
Thanks in advance for any help!
Category:
Post Situation:
EDIT: resolved this with the tutorials, apparently all i needed to do was just fill in the full sequence into the input fasta while having the relevant fragments located in the input pdb and the software did the rest for me