Urgent issue: Error with submitting a new Rosetta-Vienna RNP-ddG job

"Submitting Rosetta-Vienna RNP-ddG job failed!

Validation failed as:

• seq_file: Incorrect seq_file format. Each line should have the format:
  sequence RNAfold_energy
  
  For example:
  gggggggaucaccccccc -4.5

Please correct this errors and re-submit!"

I had faced this error in the RNP-ddG job site (https://rosie.rosettacommons.org/rnp_ddg/submit), despite having the correct file formats.

My seq_file format has the following:

auaccagcuuauucaauuugaggcggguggguggguugaauaugcugauuaccccaucggagaacguuaaggcgcuucagauaguaagugcaaucu -23.5
agaugccuguccagcaucgagcgccagcuuugcugauggguggccacccuugcccuggguuugaauuucgauccuaucgguagcuagacugcuuuguccucg -29.1
agcagcacagaggucagaugugaaacauagcauauuuacuuaugucgccuugccgguuccuaugcgugcuaccgugaa -16

I would appreciate any help on this issue, thank you.