FARFAR2 error: [ERROR: Not complementary at positions]

Any help with the following error from the rna_denovo function? Thank you

ERROR: Not complementary at positions g    4 and a   21
ERROR:: Exit from: src/core/pose/rna/RNA_SecStruct.cc line: 284

[ ERROR ]: Caught exception:

File: src/core/pose/rna/RNA_SecStruct.cc:284
[ ERROR ] UtilityExitException
ERROR: Not complementary at positions g    4 and a   21

====

my fasta file:

cgcgaauuagcgcgcgaauuagcg

the secondary structure file:

(((((((..((..))..)))))))