The problem hasn't been solved
Hi,
Could you please verify my academic email address so that I can access ROSIE via Github?
My institution name : Université de Rennes
My institution domain is : @univ-rennes.fr
Best
Hi,
I am currently trying to run a FastRelax protocol for a pore protein (4tsy) with an implicit membrane. To define the membrane I have been using the RosettaMP implementation. However, when running the AddMembraneMover I get the following segmentation fault during the AqueousPoreFinder protocol:
Greetings,
I'm trying to compile rosetta on my $SCRTACH directory in a HPC using a conda environment (Python 3.7) to use Scons. But all I get is the following error message:
scons: *** [build/src/release/linux/3.10/64/x86/gcc/12.2/mpi/AbinitioRelax.mpi.linuxgccrelease] TypeError `File /shared/software/cuda/11.7/lib64/libcufft.so.10 found where directory expected.' trying to evaluate `${_concat(LIBDIRPREFIX, LIBPATH, LIBDIRSUFFIX, __env__, RDirs, TARGET, SOURCE)}'
Hello,
I am new to Rosetta. I am trying to perform the Flex ddG tutorial in order to predict changes in binding free energies upon mutation (interface ΔΔG).
I downloaded the folder from the GitHub webpage, and I succeesfully ran the run_example_1.py script which has generated three folders with one rosetta.out files (along with other files).
Then, I ran the python3 analyze_flex_ddG.py output/ command, and I get this error:
Take 6A5E for example,it has multiple breaks. i try to feed a blueprint file with all loops,however it turn out only the first loop was remodel .guess what when i view it in pymol i still got the same number of break .
here is my command$> mpiexec -np 18 remodel.cxx11threadmpiserialization.linuxgccrelease @missing_resi_loop
and my flag file
-loops
-in:file:s FER-LLG2.pdb
-remodel:blueprint ferllgb.remodel
-run:chain B
-remodel:num_trajectory 1
-remodel:quick_and_dirty
Hello, I encountered an error while attempting to use the 'SapScoreMetric' in RosettaScript.
I encountered the following error, but when I exclude the 'SapScoreMetric' parts, it works well.
---------------------------------------------------------------
[ ERROR ]: An issue with your Rosetta run was detected
Please correct the following issue and retry:
SimpleMetric sap_score not found in basic::datacache::DataMap.
---------------------------------------------------------------
Hi,
When I ran "pdb_renumber.py", I got the " ERROR: This script requires that Biopython (http://biopython.org) is installed." Acutally I installed Biopython. Is there any suggestion.
Thanks
Hi,
I tried to install Rosetta 3.13 on Mac M1. I got the following error:
Dear users,
In NCAA tutorial, in order to use molfile_to_params_polymer.py script, we have to update the mol file by adding some additional data at the end of mol file.
Any help with the following error from the rna_denovo function? Thank you
ERROR: Not complementary at positions g 4 and a 21
ERROR:: Exit from: src/core/pose/rna/RNA_SecStruct.cc line: 284
[ ERROR ]: Caught exception:
File: src/core/pose/rna/RNA_SecStruct.cc:284
[ ERROR ] UtilityExitException
ERROR: Not complementary at positions g 4 and a 21
====
my fasta file:
cgcgaauuagcgcgcgaauuagcg
the secondary structure file:
